VIMF

AcronymDefinition
VIMFVancouver Island Music Festival (Canada)
VIMFVierer kabel In MetallFolie
VIMFVehicle Inertia Measurement Facility (SEA, Ltd., Columbus, Ohio)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
20 OXA-48-like] VIMF GTGAGTATCCGACAGTC [bla.sub.VIM-1] 18 VIMR GAGCAAGTCTAGACCG [bla.sub.VIM-1] 18 KPCF TGTCACTGTATCGCCGTC [bla.sub.KPC-1] 21 KPCR CTCAGTGCTCTACAGAAAACC [bla.sub.KPC-1] 21 SPMF CTGCTTGGATTCATGGGCGC [bla.sub.SPM-1] 22 SPMR CCTTTTCCGCGACCTTGATC [bla.sub.SPM-1] 22 Extended-spectrum [beta]-lactamases CTXM1F CGCTTTGCGATGTGCAG [bla.sub.CTX-M-1] 17 CTXM1R ACCGCGATATCGTTGGT [bla.sub.CTX-M-1] 17 SHVC AGAAGGGTTATTCT [bla.sub.SHV] 17 TATTTGTCGC SHVD TCTTTCCGATGCC [bla.sub.SHV] 23 GCCGCCAGTCA DEB ATGAGTAAACTTGGTCTGAC [bla.sub.TEM] 24 3061TEM AGGAAGCAAAGCTGAAAG [bla.sub.TEM] 25 GAATCAAATTTGG Insertion sequence ISEcp1F GCAGGTCTTTTTCTGCTCC [ISE.sub.cpl] 26 transposase ISEcp1R TTTCCGCAGCACCGTTTGC [ISE.sub.cpl] 26 transposase Table 2.