VISF

AcronymDefinition
VISFVirgin Islands Swimming Federation (Kingshill, VI)
VISFVirus-Induced Immunologic Suppressor Factor (pathology)
References in periodicals archive ?
Primer Sequence (5'-3') (1) [beta]-geo F TTATCGATGAGCGTGGTGGTTATGC [beta]-geo R GCGCGTACATCGGGCAAATAATATC (2) VISF GCCTTGCCACAGGAGATTAT VIS R AACACGCAGACTCAGGAACA (1) Primers for vector (pGT1xf).