LPL

(redirected from lipoprotein lipase)
Also found in: Dictionary, Thesaurus, Medical, Financial, Encyclopedia, Wikipedia.
Related to lipoprotein lipase: Lipoprotein lipase deficiency
AcronymDefinition
LPLLunar and Planetary Laboratory (University of Arizona)
LPLLipoprotein Lipase
LPLLambeth Palace Library (UK)
LPLLogical Page List
LPLLinuxworks Public License
LPLLayered Products Library
LPLLG Philips LCD Co, Ltd
LPLLafayette Public Library (est. 1993; Lafayette, LA)
LPLLexington Public Library (various locations)
LPLLongwood Public Library (New York)
LPLLinsco/Private Ledger Corp. (est. 1989)
LPLLock Picking Lawyer (security)
LPLLouisville Public Library (various locations)
LPLLateral Patellar Luxation (biology)
LPLLotus Programming Language
LPLLiberty Power Limited (Pakistan)
LPLLivermore Public Library (various locations)
LPLLiverpool, England, United Kingdom - Liverpool (Airport Code)
LPLLinearly Polarized Light
LPLLaborers Political League
LPLLightning Protection Level
LPLLunar Personnel Lander
LPLLarge Pulse Laser
LPLLanguage Perception Laboratory (Ohio State University)
LPLLondon Proof Litre
LPLLane Public Library (Hamilton, OH)
LPLLess-than-Pallet-Load
LPLLine-Pixel Lookahead
LPLLast Pulse Logic
LPLLimited Professional Liability
LPLLaunch Point Location
LPLLower Profit Limit
References in periodicals archive ?
NO-1886 (ibrolipim), a lipoprotein lipase activator, increases the expression of uncoupling protein 3 in skeletal muscle and suppresses fat accumulation in high-fat diet-induced obesity in rats.
Apo C-2 indicates apolipoprotein C2; CM, chylomicron; GPIHBP1, glycosylphosphatidylinositol anchored high-density lipoprotein binding protein 1; LMF-1, lipase maturation factor 1; LPL, lipoprotein lipase; VLDL, very low-density lipoprotein.
Higher serum levels of triglycerides were observed genotype in comparison south Indians.7 Metabolic syndrome in Koreans were investigated8 and haplotypes of lipoprotein lipase gene for Pvu II and Hind III alleles were constructed.
Product bp FAS CAATGGACTTCATGCCTCGGT NM 205155.2 119 GCTGGGTACTGGAAGACAAACA LPL GTGACCAAGGTAGACCAGCC NM 205282.1 92 GAAGAGACTTCAGGCAGCGT GAPDH ATGGCATCCAAGGAGTGA XM_010210168.1 141 GGGAGACAGAAGGGAACAG FAS, fatty acid synthase; LPL, lipoprotein lipase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Common mutations of the lipoprotein lipase gene and their clinical significance.
Hepatic miR-122 was reversely correlated with the expression of lipoprotein lipase. It is especially interesting observation as liver-specific miR-122 is known to promote hepatitis C virus replication and lipoprotein lipase to protect the host from HCV infection.
They are key enzymes that break down lipids and lipoproteins; lipoprotein lipase (LPL) is antagonized by two angiopoietin-like proteins ANGPTL3/4.
Gololobov et al., "Identification of a new functional domain in angiopoietin-like 3 (ANGPTL3) and angiopoietin-like 4 (ANGPTL4) involved in binding and inhibition of lipoprotein lipase (LPL)," Journal of Biological Chemistry, vol.
Schotz, "Localization of lipoprotein lipase mrna in selected rat tissues," Journal of Lipid Research, vol.
Abbreviations CVD: Cardiovascular disease TAG: Triacylglycerol VLDL: Very low density lipoprotein LDL-C: Low Density Lipoprotein Cholesterol HDL-C: High Density Lipoprotein Cholesterol FSH: Follicle stimulating hormone LH: Luteinizing hormone BMI: Body mass index LPL: Lipoprotein lipase HSL: Hormone sensitive lipase.
Lipoprotein lipase (LPL) is a central enzyme responsible for the hydrolysis of triglycerides in very low-density lipoproteins (VLDLs) and chylomicrons producing intermediate-density lipoproteins (IDLs) and chylomicron remnants, respectively (Li et al., 2014).
In the body, an enzyme known as lipoprotein lipase (LPL) works to break down triglycerides (fats).
Full browser ?