ETEC


Also found in: Dictionary, Thesaurus, Medical, Encyclopedia, Wikipedia.
Related to ETEC: EHEC
AcronymDefinition
ETECEnterotoxigenic Escherichia Coli
ETECEnergy Technology Engineering Center
ETECEast Texas Electric Cooperative (Nacogdoches, TX)
ETECExpendable Turbine Engine Concept
ETECEnglish Teachers Employment Connection (South Korea)
ETECEnhanced Tropospheric Error Compensation
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
"Panax Etec has the country's best R and D capability in terms of producing electrolytes, which is used for medium- or large-size rechargeable batteries, thus has an independence from Japanese technologies," said Lee Si-joon, president of Dongwha Enterprise's chemical business.
It is, therefore, only useful in cases where the diarrhoea would resolve without treatment or where protection of the intestinal wall is the only treatment required.The best way of preventing ETEC diarrhoea is to ensure calves consume sufficient colostrum within the first 24 hours of life to get the mother's immunity, ensure good nutrition, management and high levels of hygiene.
Children infected with ETEC and a-EPEC (41.0% and 48.6%, respectively) had watery stools while those infected with EAEC had formed stools (53.2%, n=33) (Table 4).
Unfortunately, there are no available vaccines to prevent ETEC infections, so travellers must constantly be concerned about what they eat and drink while on vacation.
Since 1989, Etec has introduced approximately 160 products, developing a balanced portfolio of differentiated solutions for New Zealand growers.
"Collectively, these data provide additional insight into the complex molecular basis of severe ETEC diarrheal illness that may inform rational design of vaccines to protect those at highest risk," the authors write.
Monolayers of IPEC-1 cells were incubated for 6 h in DMEM without serum or antibiotics, in the presence of ETEC K88 (1 x [10.sup.7] CFU), L.
coli Alr gene CTGGAAGAGGCTAGCCTGGACGAG 366 AAAATCGGCACCGGTGGAGCGATC ETEC sta ATTTTTCTTTCTGTATTGTCTT 180 CACCCGGTACAAGCAGGATT EIEC ial CTGGTAGGTATGGTGAGG 320 CCAGGCCAACAATTATTTCC EHEC hlyA GCATCATCAAGCGTACGTTCC 534 AATGAGCCAAGCTGGTTAAGCT Table 2.
Factors to be considered are: The species of pigs used in the different experiments, age of pigs at the time of challenge, variation in the volume and dosage of inoculants used, buffer type and method of delivery of the inoculants into the oral cavity of pigs, health status of pigs prior to ETEC challenge, duration of the experiment and duration of acclimatization prior to challenge.